Correction: eIF2B conformation and assembly state regulate the integrated stress response
Main text
Schoof M, Boone M, Wang L, Lawrence R, Frost A, Walter P. 2021. eIF2B conformation and assembly state regulate the integrated stress response. eLife 10:e65703. doi: 10.7554/eLife.65703.
Published 10 March 2021
In the published article, there is an error in the inline Table 2 for Oligos and sgRNAs. The Sequence for sgMS006 was incorrectly shown as “GTGTGTGGTTGTCATTAGGG” which is the sequence used to target eIF2α, not eIF2Bα. The correct sequence is “GAGGACGCCATGGACGACAA” and the correct target is eIF2Bα not eIF2β as erroneously stated in the table.
The corrected Table 2 is shown here:
Table 2. Oligos and sgRNAs.
Oligo | Sequence | Use |
---|---|---|
MS266 | /5InvddT/G*G*G*A*A*CCTCTTCTGTAACTCCTTAGC | Amplify HDR template |
MS267 | /5InvddT/C*C*T*G*A*G*GGCAAACAAGTGAGCAGG | Amplify HDR template |
MS269 | TCGTGCCAGCCCCCTAATCT | Validate eIF2Bα tagging |
MS270 | CTGAACGGCGCTGCTGTAGC | Validate eIF2Bα tagging |
MS256 | AGTGAACTCTACCATCCTGA | Validate eIF2Bβ tagging |
MS258 | TTAGGTGGACTCCTGTGC | Validate eIF2Bβ tagging |
MS096 | CTGGCTAACTGGCAGAACC | Validate eIF2Bδ tagging |
MS268 | AGAAACAAAGGCAGCAGAGT | Validate eIF2Bδ tagging |
sgMS001 | CAATCTGCTTAGGACACGTG | Target Cas9 to eIF2Bβ C-terminus |
sgMS004 | AGAGCAGTGACCAGTGACGG | Target Cas9 to eIF2Bδ C-terminus |
sgMS006 | GAGGACGCCATGGACGACAA | Target Cas9 to eIF2Bα N-terminus |
HDR: homology-directed recombination. |
The originally published Table 2 is shown for reference:
Table 2. Oligos and sgRNAs.
Oligo | Sequence | Use |
---|---|---|
MS266 | /5InvddT/G*G*G*A*A*CCTCTTCTGTAACTCCTTAGC | Amplify HDR template |
MS267 | /5InvddT/C*C*T*G*A*G*GGCAAACAAGTGAGCAGG | Amplify HDR template |
MS269 | TCGTGCCAGCCCCCTAATCT | Validate eIF2Bα tagging |
MS270 | CTGAACGGCGCTGCTGTAGC | Validate eIF2Bα tagging |
MS256 | AGTGAACTCTACCATCCTGA | Validate eIF2Bβ tagging |
MS258 | TTAGGTGGACTCCTGTGC | Validate eIF2Bβ tagging |
MS096 | CTGGCTAACTGGCAGAACC | Validate eIF2Bδ tagging |
MS268 | AGAAACAAAGGCAGCAGAGT | Validate eIF2Bδ tagging |
sgMS001 | CAATCTGCTTAGGACACGTG | Target Cas9 to eIF2BβC-terminus |
sgMS004 | AGAGCAGTGACCAGTGACGG | Target Cas9 to eIF2Bδ C-terminus |
sgMS006 | GTGTGTGGTTGTCATTAGGG | Target Cas9 to eIF2β N-terminus |
HDR: homology-directed recombination. |
The article has been corrected accordingly.
Article and author information
Author details
Version history
Copyright
© 2024, Schoof et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
-
- 260
- views
-
- 0
- citations
Views, downloads and citations are aggregated across all versions of this paper published by eLife.